Question: D Question 1 1 pts The DNA sequence below is the sense strand of a gene that transcribed into a s…


D Question 1 1 pts The DNA sequence below is the sense strand of a gene that transcribed into a short monocistronic mRNA. 5 GGCAATGCGTAAATTTTGAAAAGTA 3 The DNA picked up a mutation turning it into 5 GGCAATGCGTAAATTTGAAAAGTA 3. What type of mutation is this? O Frameshift leading to shorter protein product O Silent O Frameshift leading to longer protein product Missense None of the above

Show transcribed image text

D Question 1 1 pts The DNA sequence below is the sense strand of a gene that transcribed into a short monocistronic mRNA. 5' GGCAATGCGTAAATTTTGAAAAGTA 3' The DNA picked up a mutation turning it into 5' GGCAATGCGTAAATTTGAAAAGTA 3. What type of mutation is this? O Frameshift leading to shorter protein product O Silent O Frameshift leading to longer protein product Missense None of the above

(Visited 1 times, 1 visits today)
Translate ยป