Question: AG U Phenyl-ut CUS If the first G changes to A what kind of mutation will happen? Show the change…


AG U Phenyl-ut CUS If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. 11s A tyrt of ans by A TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. TACCTA-CACACATGTAGGTGGGCAAAGTT Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)
media%2F45c%2F45cab5b3-72b0-4427-ab53-b8
media%2F043%2F043cac1c-7fab-4f1c-8bff-87

Show transcribed image text

AG U Phenyl-ut CUS If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. 11's A tyrt of ans by A TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. TACCTA-CACACATGTAGGTGGGCAAAGTT Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)

(Visited 1 times, 1 visits today)
Translate »