Question: 6. The following diagram is a DNA segment from a bacterial genome Please identify and answer the …


6. The following diagram is a DNA segment from a bacterial genome Please identify and answer the following elements/questions in the order given (A, B, C, D, and E) Top Strand DI 35 -10 o2 5 C. Which strand is used as template (top or bottom)?E.What is the Transcript Sequence (written in 5-3)? Bottom Strand a. Promoter, Start Site, Bottom Strand, Terminator, 5- AGAGTCAGTG...GTACTCCCGCCGCCAGAAGGCCTGG CGGCATTTT-3 b. Terminator, Stop Site, Top Strand, Initiator, 5- TCTCAGTCAC...CATGAGGGGCGGCGGTCTTCCGGACC GCCİTAAAA-3 c. Start Site, Promoter, Top Strand, Terminator, 5- AGAGTCAGTG...GTACTCCCGCCGCCAGAAGGCCTGG CGGCATTTT-3 d. Promoter, Stop Site, Bottom Strand, Initiator, 5- AGAGTCAGTG...GTACTCCCGCCGCCAGAAGGCCTGG CGGCATTTT-3 7. The collection of all the proteins and factors, including RNA polymerase, that help start eukaryotic transcription is termed a. Transcription Initiation Complex b. General Transcription Complex c. General Regulation Complex d. Translation Initiation Complex e. Transcription Regulatory Complex

Show transcribed image text

6. The following diagram is a DNA segment from a bacterial genome Please identify and answer the following elements/questions in the order given (A, B, C, D, and E) Top Strand DI 35 -10 o2 5 C. Which strand is used as template (top or bottom)?E.What is the Transcript Sequence (written in 5-3)? Bottom Strand a. Promoter, Start Site, Bottom Strand, Terminator, 5'- AGAGTCAGTG…GTACTCCCGCCGCCAGAAGGCCTGG CGGCATTTT-3' b. Terminator, Stop Site, Top Strand, Initiator, 5'- TCTCAGTCAC…CATGAGGGGCGGCGGTCTTCCGGACC GCCİTAAAA-3 c. Start Site, Promoter, Top Strand, Terminator, 5'- AGAGTCAGTG…GTACTCCCGCCGCCAGAAGGCCTGG CGGCATTTT-3" d. Promoter, Stop Site, Bottom Strand, Initiator, 5'- AGAGTCAGTG…GTACTCCCGCCGCCAGAAGGCCTGG CGGCATTTT-3 7. The collection of all the proteins and factors, including RNA polymerase, that help start eukaryotic transcription is termed a. Transcription Initiation Complex b. General Transcription Complex c. General Regulation Complex d. Translation Initiation Complex e. Transcription Regulatory Complex

(Visited 1 times, 1 visits today)
Translate »