Question: 5. DNA contains the sugar , while RNA contains the sugar 6. During DNA replication, two DNA stran…


5. DNA contains the sugar , while RNA contains the sugar 6. During DNA replication, two DNA strands are produced. Each new DNA molecule has one strand and one strand. The bases in DNA and RNA are the same except that RNA has have 7. and does not When making a protein, DNA is converted into , which is then converted into a 8. If a hypothetical protein is 450 amino acid long, how many DNA bases is in the coding sequence? 9. 10. DNA sequence: TACCAGTAGGTTAGCCAAATT mRNA sequence: Amino acid sequence:

Show transcribed image text

5. DNA contains the sugar , while RNA contains the sugar 6. During DNA replication, two DNA strands are produced. Each new DNA molecule has one strand and one strand. The bases in DNA and RNA are the same except that RNA has have 7. and does not When making a protein, DNA is converted into , which is then converted into a 8. If a hypothetical protein is 450 amino acid long, how many DNA bases is in the coding sequence? 9. 10. DNA sequence: TACCAGTAGGTTAGCCAAATT mRNA sequence: Amino acid sequence:

(Visited 8 times, 1 visits today)
Translate ยป