Question: (40 pts) You are a researcher who wants to clone the rps23 gene (encoding the small ribosomal pro…


(40 pts) You are a researcher who wants to clone the rps23 gene (encoding the small ribosomal protein 23; sequence below) from the yeast S. cerevisiae. You have decided that in your cloning strategy you want to add a C-terminal 3xFLAG tag, as you do not have the resources or time to make an antibody to the RPS23 protein product. You have a cloning vector that will encode an in-frame C-terminal 3xFLAG ta on any inserted gene if you use any two of the following four restriction sites: SacI (5 GAGCTAC, 5 overhang), HindIII (5, AAGCTT, 3, overhang), EcoRI (5, GAATTC, 3, overhang), and Xbal (5, T^CTAGA, 3 overhang). You have decided to use PCR to clone the rps23 gene into this vector starting at the start codon and encompassing the entire gene. Design two oligos to amplify the rps23 gene (sequence below) and create a cloning strategy for how you would clone this gene into the 3xFLAG vector, describing each step you would perform (one sentence per step) 5gctaagttcacctaaatccaacacacagttcgccgcaacctctatactacaaaATGGGAAAACCCGCAGGATTGAACGCCGCTCG TAAGCTTCGCAATCATCGCCGTGAGGAGCGTTGGGCCGATGCTCATTACAAGAAGCGCTTATTGGGAACCGC TTACAAGTCATCACCTTTCGGTGGATCGTCTCATGCTAAGGGTATCGTTGTCGAAAAGATTGGTGTAGAAGC TAAGCAACCTAACTCTGCTATTCGTAAATGTGTTCGTGTTCAGTTGATCAAGAATGGTAAGAAAGTTACCGC TTTCGTTCCCCACGATGGTTGTCTCAACTTCGTTGATGAAAACGACGAAGTTCTTCTTTCTGGTTTCGGTCG TAAGGGCAAGGCTAAGGGTGATATTCCCGGTGTCCGTTTCAAGGTCGTCAAGGTTGCCGGTGTTGGTCTTTC TGCTCTTTTCCATGAGAAGAAGGAAAAGCCTAGAGCTTAAacgaacttaataaaaagttgtttgtctca

Show transcribed image text

(40 pts) You are a researcher who wants to clone the rps23 gene (encoding the small ribosomal protein 23; sequence below) from the yeast S. cerevisiae. You have decided that in your cloning strategy you want to add a C-terminal 3xFLAG tag, as you do not have the resources or time to make an antibody to the RPS23 protein product. You have a cloning vector that will encode an in-frame C-terminal 3xFLAG ta on any inserted gene if you use any two of the following four restriction sites: SacI (5' GAGCTAC, 5 overhang), HindIII (5, A"AGCTT, 3, overhang), EcoRI (5, GAATTC, 3, overhang), and Xbal (5, T^CTAGA, 3" overhang). You have decided to use PCR to clone the rps23 gene into this vector starting at the start codon and encompassing the entire gene. Design two oligos to amplify the rps23 gene (sequence below) and create a cloning strategy for how you would clone this gene into the 3xFLAG vector, describing each step you would perform (one sentence per step) 5'gctaagttcacctaaatccaacacacagttcgccgcaacctctatactacaaaATGGGAAAACCCGCAGGATTGAACGCCGCTCG TAAGCTTCGCAATCATCGCCGTGAGGAGCGTTGGGCCGATGCTCATTACAAGAAGCGCTTATTGGGAACCGC TTACAAGTCATCACCTTTCGGTGGATCGTCTCATGCTAAGGGTATCGTTGTCGAAAAGATTGGTGTAGAAGC TAAGCAACCTAACTCTGCTATTCGTAAATGTGTTCGTGTTCAGTTGATCAAGAATGGTAAGAAAGTTACCGC TTTCGTTCCCCACGATGGTTGTCTCAACTTCGTTGATGAAAACGACGAAGTTCTTCTTTCTGGTTTCGGTCG TAAGGGCAAGGCTAAGGGTGATATTCCCGGTGTCCGTTTCAAGGTCGTCAAGGTTGCCGGTGTTGGTCTTTC TGCTCTTTTCCATGAGAAGAAGGAAAAGCCTAGAGCTTAAacgaacttaataaaaagttgtttgtctca

(Visited 1 times, 1 visits today)
Translate »