Question: 2. What is the -35 consensus sequence for the following sequences? Gene 1 Gene 2 GAGTTCTTGCTTTCTA…


2. What is the -35 consensus sequence for the following sequences? Gene 1 Gene 2 GAGTTCTTGCTTTCTAACGTGAAAGRGGTITAGGTTAAAAGAC-ATCA Gene 3 CGAAAGGCG Gene 4 Gene 5 CAATACT ATTAT ACACC CAACACTTGATACTGTATGAGCATACA A) TTGATA B) TATGAT C) TATTAT D) ACAA E) TAGTAT

Show transcribed image text

2. What is the -35 consensus sequence for the following sequences? Gene 1 Gene 2 GAGTTCTTGCTTTCTAACGTGAAAGRGGTITAGGTTAAAAGAC-ATCA Gene 3 CGAAAGGCG Gene 4 Gene 5 CAATACT ATTAT ACACC CAACACTTGATACTGTATGAGCATACA A) TTGATA B) TATGAT C) TATTAT D) ACAA E) TAGTAT

(Visited 1 times, 1 visits today)
Translate »