Question: 2. The effects of mutations on a consensus sequence One of the genes studies in this paper is the…


2. The effects of mutations on a consensus sequence One of the genes studies in this paper is the human gene TPII gene, which encodes triosephosphate isomerase 1. When this gene is deficient, it is associated with lower neuron viability and learning and memory deterioration. There is a mutation in the promoter region that contains the TATA box. The wild-type and mutant sequences are: WT GCGCTCTATATAAGTGGGCAG MUT GCGCTCTATAGAAGTGGGCAG Can you find the TATA box in this sequence? Do you predict that this mutation increases or decreases the strength of binding of TATA-binding protein to the promoter?

Show transcribed image text

2. The effects of mutations on a consensus sequence One of the genes studies in this paper is the human gene TPII gene, which encodes triosephosphate isomerase 1. When this gene is deficient, it is associated with lower neuron viability and learning and memory deterioration. There is a mutation in the promoter region that contains the TATA box. The wild-type and mutant sequences are: WT GCGCTCTATATAAGTGGGCAG MUT GCGCTCTATAGAAGTGGGCAG Can you find the TATA box in this sequence? Do you predict that this mutation increases or decreases the strength of binding of TATA-binding protein to the promoter?

(Visited 1 times, 1 visits today)
Translate »